Familial Mediterranean Fever

Alternative Names

  • FMF
  • Familial Mediterranean Fever, Autosomal Recessive
  • Polyserositis, Recurrent
  • Polyserositis, Familial Paroxysmal
Back to search Result
WHO-ICD-10 version:2010

Endocrine, nutritional and metabolic diseases

Metabolic disorders

OMIM Number

249100

Mode of Inheritance

Autosomal recessive

Gene Map Locus

16p13.3

Description

Familial Mediterranean fever is an autosomal recessive disorder mostly prevalent in Mediterranean populations. It is characterized by recurrent self-limited episodes of fever, arthritis, serositis, and skin rash, with marked accumulations of polymorphonuclear leukocytes in affected areas during attacks. The most severe complication of the disorder is the development of amyloidosis, leading to nephrotic syndrome and end-stage renal disease. Two disease phenotypes have been identified, whether amyloidosis appears years after the appearance of the other clinical signs (phenotype I), or whether it is the first or the only familial Mediterranean fever presenting sign (phenotype II), which is less frequent. Estimates of the incidence of FMF in specific eastern Mediterranean populations range from 1 in 2000 to 1 in 100, depending on the population studied

Molecular Genetics

Familial Mediterranean fever is caused by mutation in the MEFV gene. Over 35 mutations have been discovered so far. The 5 most frequent mutations are M694V, M694I, V726A, M680I and E148Q. The FMF gene, encodes a 781-aa protein denoted pyrin, which is expressed primarily in neutrophils, eosinophils, and cytokine-activated monocytes.

Epidemiology in the Arab World

View Map
Subject IDCountrySexFamily HistoryParental ConsanguinityHPO TermsVariantZygosityMode of InheritanceReferenceRemarks
249100.G.3.1JordanYesYes Recurrent fever; Abdominal pain; Art... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveMedlej-Hashim et al, 2000 Group of patients in...
249100.G.3.2JordanYesYes Recurrent fever; Abdominal pain; A... NM_000243.3:c.2177T>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000 Group of 12 heterozy...
249100.G.3.3JordanYesYes Recurrent fever; Abdominal pain; ... NM_000243.3:c.2040G>CHomozygousAutosomal, RecessiveMedlej-Hashim et al, 2000 Group of patients in...
249100.G.3.4JordanYesYes Recurrent fever; Abdominal pain; ... NM_000243.3:c.442G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000 Group of 6 heterozyg...
249100.G.3.5JordanYesYes Recurrent fever; Abdominal pain; ... NM_000243.3:c.2230G>THeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000 Group of 2 heterozyg...
249100.1.1JordanYesYes Recurrent fever; Abdominal pain; ... NM_000243.3:c.2082G>AHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000
249100.1.2JordanYesYes Recurrent fever; Abdominal pain; Art... NM_000243.3:c.1437C>GHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000
249100.1.3JordanYesYes Recurrent fever; Abdominal pain; A... NM_000243.3:c.800C>THeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2000
249100.G.5.1Jordan Familial Mediterranean Fever... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.5.2Jordan Familial Mediterranean Fever... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.5.3Jordan Familial Mediterranean Fever... NM_000243.3:c.2082G>AHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated h...
249100.G.5.4Jordan Familial Mediterranean Fever... NM_000243.3:c.2040G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.5.5Jordan Familial Mediterranean Fever... NM_000243.3:c.442G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.3.1Jordan Familial Mediterranean Fever... NM_000243.3:c.2230G>THeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.3.2Jordan Familial Mediterranean Fever... NM_000243.3:c.800C>THeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.3.3Jordan Familial Mediterranean Fever... NM_000243.3:c.1437C>GHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.3.4Jordan Familial Mediterranean Fever... NM_000243.3:c.2160C>GHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.G.7.1Jordan; Lebanon Periodic Fever; Abdominal pain; Amyloido... Alpha NM_199161.5:c.[209C>T;224T>C]HomozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 11 FMF pati...
249100.G.7.2Jordan; Lebanon Periodic Fever; Abdominal pain... Alpha NM_199161.5:c.[209C>T;224T>C]HomozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 10 FMF pati...
249100.G.7.3Jordan; Lebanon Periodic Fever; Abdominal pain; Amyloido... Alpha NM_199161.5:c.[209C>T;224T>C], Beta NM_199161.5:c.[209=;224=]HeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 16 FMF pati...
249100.G.7.4Jordan; Lebanon Periodic Fever; Abdominal pain... Alpha NM_199161.5:c.[209C>T;224T>C], Beta NM_199161.5:c.[209=;224=]HeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 15 FMF pati...
249100.G.7.7Jordan; Lebanon Periodic Fever; Abdominal pain... Beta NM_199161.5:c.[209=;224=], Gamma NM_199161.5:c.[209=;224T>C]HeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 4 FMF patie...
249100.G.7.5Jordan; Lebanon Periodic Fever; Abdominal pain; Amyloido... Beta NM_199161.5:c.[209=;224=]HomozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 3 FMF patie...
249100.G.7.6Jordan; Lebanon Periodic Fever; Abdominal pain... Beta NM_199161.5:c.[209=;224=]HomozygousAutosomal, RecessiveMedlej-Hashim et al. 2004 Group of 11 FMF pati...
249100.G.8.1Lebanon Periodic fever; Abdominal pain... IL1B (-511)HomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 6 FMF patie...
249100.G.8.2Lebanon Periodic fever; Abdominal pain... IL1B (-511)HeterozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 28 heterozy...
249100.G.9.1Lebanon Periodic fever; Abdominal pain... IL1B (-31) NM_000576.2:c.-118C>THomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 12 FMF pati...
249100.G.9.2Lebanon Periodic fever; Abdominal pain... IL1B (-31) NM_000576.2:c.-118C>THeterozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 23 heterozy...
249100.G.9.3Lebanon Periodic fever; Abdominal pain... IL1B (-31) NM_000576.2:c.-118C>THomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 7 homozygou...
249100.G.8.3Lebanon Periodic fever; Abdominal pain... IL1B (-511)HomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 8 homozygou...
249100.G.10.1Lebanon Periodic fever; Abdominal pain... IL1B (+3954) NM_000576.3:c.315C>THomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 22 FMF pati...
249100.G.10.2Lebanon Periodic fever; Abdominal pain... IL1B (+3954) NM_000576.3:c.315C>THeterozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 19 heterozy...
249100.43Lebanon Periodic fever; Abdominal pain... IL1B (+3954) NM_000576.3:c.315C>THomozygousAutosomal, RecessiveIbrahim et al. 2015 1 homozygous FMF pat...
249100.G.11Lebanon Periodic fever; Abdominal pain... 86 bp VNTR NM_173842.3:c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2]HomozygousAutosomal, RecessiveIbrahim et al. 2015 Group of 42 FMF pati...
249100.4LebanonUnknownYes Periodic fever; Edema; Urticaria... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveJalkh et al. 2019
249100.G.6.1Lebanon Abdominal pain; Arthritis; Amyloidosis... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveMansour et al. 2001 Group of unrelated L...
249100.G.6.2Lebanon Abdominal pain; Arthritis... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveMansour et al. 2001 Group of unrelated L...
249100.G.6.3Lebanon Abdominal pain; Arthritis; Amyloidosis... NM_000243.3:c.2082G>AHomozygousAutosomal, RecessiveMansour et al. 2001 Group of unrelated L...
249100.G.6.4Lebanon Abdominal pain; Arthritis... NM_000243.3:c.442G>CHeterozygousAutosomal, RecessiveMansour et al. 2001 Group of unrelated L...
249100.5Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_005041.5:c.272C>T, NM_006949.4:c.1034C>THeterozygous, HomozygousAutosomal, RecessiveUmar et al, 2020
249100.6Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2177T>C, NM_199242.2:c.610A>G, NM_207585.2:c.611C>GHeterozygous, HomozygousAutosomal, RecessiveUmar et al, 2020
249100.7Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.442G>C, NM_000243.3:c.2177T>C, NM_207585.2:c.611C>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.8Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_000243.3:c.2177T>C, NM_207585.2:c.611C>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.9Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2082G>A, NM_000243.3:c.2040G>C, NM_207585.2:c.611C>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.10Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2177T>C, NM_022168.3:c.1126G>A, NM_024110.4:c.239G>AHeterozygous, HomozygousAutosomal, RecessiveUmar et al, 2020
249100.11Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2082G>A, NM_000243.3:c.2040G>C, NM_005041.5:c.1153C>T, NM_004633.4:c.932T>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.12Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_000243.3:c.-397C>G, NM_003978.5:c.37-10081C>G, NM_022350.4:c.1040C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.13Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_000243.3:c.-1309G>A, NM_002661.5:c.82A>T, NM_001243.5:c.1511G>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.14Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2082G>A, NM_005041.5:c.272C>T, NM_003839.4:c.1348C>T, NM_207585.2:c.611C>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.15Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_012114.3:c.418G>AHeterozygous, HomozygousAutosomal, RecessiveUmar et al, 2020
249100.16Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2230G>T, NM_000882.4:c.631G>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.17Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2084A>G, NM_004633.4:c.932T>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.18Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_005041.5:c.1153C>T, NM_004580.5:c.17A>G, NM_022162.3:c.2230C>T, NM_003327.3:c.384C>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.19Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_199242.2:c.670C>T, NM_001143906.1:c.908A>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.20Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.1105C>T, NM_000243.3:c.1223G>A, NM_000629.3:c.954G>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.21Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2082G>A, NM_000629.3:c.954G>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.22Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_005041.5:c.272C>T, NM_004163.4:c.274G>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.23Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_001270508.1:c.406C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.24Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2080A>G, NM_004895.5:c.2861C>T, NM_001122681.2:c.1429C>T, NM_004633.4:c.932T>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.25Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2177T>C, NM_006949.4:c.1034C>T, NM_003839.4:c.1234G>T, NM_207585.2:c.611C>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.26Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.2230G>T, NM_001039569.2:c.11T>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.27Lebanon Periodic fever; Abdominal pain... NM_000243.3:c.-123A>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.28Lebanon Periodic fever; Abdominal pain... NM_022162.3:c.2127G>A, NM_018725.4:c.529G>A, NM_006669.6:c.997G>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.29Lebanon Periodic fever; Abdominal pain... NM_003978.5:c.203C>A, NM_207585.2:c.611C>G, NM_000575.4:c.526G>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.30Lebanon Periodic fever; Abdominal pain... NM_017852.4:c.2672G>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.31Lebanon Periodic fever; Abdominal pain... NM_006949.4:c.1034C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.32Lebanon Periodic fever; Abdominal pain... NM_016442.4:c.1378G>CHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.33Lebanon Periodic fever; Abdominal pain... NM_003327.3:c.384C>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.34Lebanon Periodic fever; Abdominal pain... NM_003811.4:c.716G>A, NM_018725.4:c.529G>A, NM_178844.3:c.2401G>A, NM_000201.3:c.1099C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.35Lebanon Periodic fever; Abdominal pain... NM_003263.4:c.1013T>C, NM_022350.4:c.1040C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.36Lebanon Periodic fever; Abdominal pain... NM_001122681.2:c.1429C>T, NM_018724.3:c.225+1G>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.37Lebanon Periodic fever; Abdominal pain... NM_001366385.1:c.1789C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.38Lebanon Periodic fever; Abdominal pain... NM_022162.3:c.2883-2A>GHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.39Lebanon Periodic fever; Abdominal pain... NM_022168.4:c.2597C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.40Lebanon Periodic fever; Abdominal pain... NM_022168.4:c.2597C>T, NM_018725.4:c.529G>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.41Lebanon Periodic fever; Abdominal pain... NM_002176.4:c.498A>G, NM_017563.5:c.1696C>T, NM_022350.4:c.1040C>THeterozygousAutosomal, RecessiveUmar et al, 2020
249100.42Lebanon Periodic fever; Abdominal pain... NM_005041.5:c.1153C>T, NM_024618.4:c.1480G>AHeterozygousAutosomal, RecessiveUmar et al, 2020
249100.G.4.6Lebanon Familial Mediterranean Fever... NM_000243.3:c.2282G>AHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.2.1Lebanon Familial Mediterranean Fever... NM_000243.3:c.1958G>AHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.2Lebanon Familial Mediterranean Fever... NM_000243.3:c.2084A>GHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.3Lebanon Familial Mediterranean Fever... NM_000243.3:c.2230G>THeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.4Lebanon Familial Mediterranean Fever... NM_000243.3:c.322A>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.5Lebanon Familial Mediterranean Fever... NM_000243.3:c.501G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.6Lebanon Familial Mediterranean Fever... NM_000243.3:c.443A>THeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.2.7Lebanon Familial Mediterranean Fever... NM_000243.3:c.530C>THeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005
249100.G.4.5Lebanon Familial Mediterranean Fever... NM_000243.3:c.442G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.4.4Lebanon Familial Mediterranean Fever... NM_000243.3:c.2040G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.4.3Lebanon Familial Mediterranean Fever... NM_000243.3:c.2082G>AHomozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.4.2Lebanon Familial Mediterranean Fever... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.4.1Lebanon Familial Mediterranean Fever... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveMedlej-Hashim et al. 2005 Group of unrelated p...
249100.G.1.1Lebanon Familial Mediterranean Fever... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.2Lebanon Familial Mediterranean Fever... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.3Lebanon Familial Mediterranean Fever... NM_000243.3:c.442G>CHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.4Lebanon Familial Mediterranean Fever... NM_000243.3:c.2230G>THomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.5Lebanon Familial Mediterranean Fever... NM_000243.3:c.2040G>CHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.6Lebanon Familial Mediterranean Fever... NM_000243.3:c.2082G>AHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.7Lebanon Familial Mediterranean Fever... NM_000243.3:c.1437C>GHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.8Lebanon Familial Mediterranean Fever... NM_000243.3:c.2282G>AHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.9Lebanon Familial Mediterranean Fever... NM_000243.3:c.2076_2078delHomozygousAutosomal, RecessiveSabbagh et al, 2008 Group of patients in...
249100.G.1.10Lebanon Familial Mediterranean Fever... NM_000243.3:c.1105C>THeterozygousAutosomal, RecessiveSabbagh et al, 2008 Group of 2 heterozyg...
249100.G.2.1LebanonYesYes Familial Mediterranean Fever... NM_000243.3:c.2082G>AHomozygousAutosomal, RecessiveMedlej-Hashim et al, 2011 Group of FMF patient...
249100.G.2.2LebanonYesYes Familial Mediterranean Fever... NM_000243.3:c.2177T>CHomozygousAutosomal, RecessiveMedlej-Hashim et al, 2011 Group of FMF patient...
249100.G.2.3LebanonYesYes Familial Mediterranean Fever... NM_000243.3:c.2080A>GHomozygousAutosomal, RecessiveMedlej-Hashim et al, 2011 Group of FMF patient...
249100.G.2.4LebanonYesYes Familial Mediterranean Fever... NM_000243.3:c.442G>CHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2011 Group of 2 compound ...
249100.G.2.5LebanonYesYes Familial Mediterranean Fever... NM_000243.3:c.2282G>AHeterozygousAutosomal, RecessiveMedlej-Hashim et al, 2011 Group of 2 compound ...

Other Reports

Bahrain

Zayyani (1987) described some of the very first cases of FMF in the Arabian Peninsula. One of the cases was of a 37-year old Bahraini female, born to healthy, consanguineous parents, originating from Saudi Arabia. She presented with recurrent attacks of abdominal pain, accompanied with fever and vomiting, about twice a month. Earlier, repeated investigations with barium enemas, upper GI series, abdominal ultrasonography, and serum amylase determination did not yield any conclusive findings. Upon examination, her abdomen was slightly distended, with diminished bowel sounds. Upon palpitation of the abdomen, diffused tenderness, rebound, and guarding were elicited. Radiological examination of the abdomen showed dilated small bowel loops with air-fluid levels. The fever and abdominal pain subsided in 24 hrs. The patient was then tested for FMF using the metaraminol provocative test. Within three hours, the patient had a recurrence of her typical attack, confirming the diagnosis of FMF. The patient was then started on colchicine as oral medication. In the year subsequent to starting this treatment, she was found to have only one recurrence of her attack.

[Zayyani NR. Familial Mediterranean fever in the Arabian Peninsula: Case reports and review of literature. Bahrain Med Bull. 1987; 9(3):130-6.]

Egypt

One of the cases described by Zayyani (1987) in her review of the very first cases of FMF in the Arabian Peninsula, was a 28-year old Egyptian woman, with unrelated parents and no family history of the disease. She had been complaining of recurrent attacks of abdominal pain, pain in the chest and both knees, skin rash and fever, since 9-years of age. The attacks lasted three days and recurred three to four times a month. The patient had undergone two operations previously on the onset of attacks; one of them an appendectomy, and the other a right hemicolectomy. However, the abdominal pain persisted, and post-hemicolectomy was accompanied with diarrhea. Upon examination during one of the attacks, direct and rebound tenderness was elicited all over upon palpitation of the abdominal rigidity. Radiological examination showed distension of the small and large bowel loops, and a small left pleural effusion. She was diagnosed with FMF, and was put on colchicine. Consequently, she had three recurrences in the following year.

[Zayyani NR. Familial Mediterranean fever in the Arabian Peninsula: Case reports and review of literature. Bahrain Med Bull. 1987; 9(3):130-6.]

Dajani et al. (1987) described four Egyptian patients (three males and 1 female) residing in the UAE who were diagnosed as having periodic peritonitis, or familial Mediterranean fever. Their ages ranged between 26 to 50 years. Patients suffered from fever and acute self-limiting attacks of abdominal pain occurring at a frequency of 6-15 episodes/ year. Two of them underwent three abdominal operations and the other two patients had only one abdominal operation. Pleuritic chest pain was seen in three patients and one of them had a pleural rub during the attack. Three patients had peripheral joints involvement. Cervical spondylosis was observed in two cases and lactose intolerance in one patient. Metaraminol provocation was then performed three days after stopping maintenance colchicine therapy to confirm the diagnosis. Three of the patients were found to react positively to the metaraminol infusion by reproducing the attacks they experienced before. All of the patients had already shown a significant control of the illness by colchicine, whether during the acute attacks or during prophylactic maintenance therapy. Therefore, Dajani et al. (1987) concluded that the metaraminol provocation test would provide good support to the diagnosis of familial Mediterranean fever with a sensitivity index of 90%. The colchicine response, however, appeared more sensitive.

[Dajani AI, Awad SM, Jaber YI. Diagnosis of periodic peritonitis - Evaluation of metaraminol provocation test and colchicine therapeutic trial. Emirates Med J. 1987; 5:133-7.]

Iraq

Yuval et al. (1995) found 77 families, with 240 FMF patients, in which the disorder affected more than one generation. In 75 of these families, the occurrence of FMF in more than one generation was found to be consistent with a recessive mode of inheritance due to a high gene frequency and consanguinity of the parents. In 2 families, however, one of Ashkenazi and the other of Georgian Iraqi origin, in which FMF occurred in 4 consecutive generations, the transmission could be explained only by autosomal dominant inheritance.

Pras et al. (1998) commented that North African Jews and Iraqi Jews were the 2 largest population groups suffering from FMF in Palestine.

[See also: Libya > Daniels et al., 1995; Morocco > Aksentijevich et al., 1993].

Jordan

Rawashdeh and Majeed (1996) reviewed findings from the FMF pediatric patient population in northern Jordan (all children were of Jordanian, Palestinian, or Syrian origin). The 192 patients first presented between the age of 4 months and 16 years. The mean delay in diagnosis was 3.7 years and was increased for children who presented before the age of 2 years. Abdominal pain was the most common presenting symptom and occurred in 51%, while arthritis and pleuritis occurred in 26% and 23%, respectively. The investigators noted that family history was positive in 62% of the children, which was not surprising in this autosomal recessive disorder given the 64% consanguinity rate in northern Jordan. Minimum prevalence was given as 1 in 2,600 with an estimated gene frequency in the childhood population of 1 in 50 (calculated on the numbers of diagnosed patients). The authors warned that the frequency of FMF among Jordanian Arab children was greater than previously estimated. Majeed et al. (1999) studied the clinical profiles of 476 Jordanian and Palestinian children (54% females) diagnosed with FMF during a period of 8 years with an aim to delineate the phenotype of the condition among Arab patients. The high number of patients pointed to the high prevalence of FMF in the region. Of these patients, 59% had a positive family history of the condition. The peak age of onset was between the ages of 2 and 10-years. Serum IgD was assayed in 93 patients, and mean levels were found to be 29.5 mg/l. IgD levels of >60 mg/l were seen in 13 of these patients. The most common presenting feature was abdominal pain (56%), followed by arthritis (22%), and chest pain (15%). Other rare features seen where: episodic fever (3%), myalgia (3%), and scrotal swelling (1%). Renal complications of FMF were rare in this patient set. Only two patients developed proteinuria, one in isolation, and the other with hematuria. This is in contrast to reports form other communities, especially Jewish, which have reported a high prevalence of amyloidosis among patients with FMF. However, 36 family members of 19 proband in this series exhibited chronic renal failure, indicating a predisposition to nephropathy in families affected with FMF. All patients were treated with colchicine, and the response was favorable in 96% of the patients. Majeed et al. (1999) stated that conditions like Hyper IgD syndrome share several features with FMF, and care should be taken to differentiate between the two conditions. They also suggested a therapeutic test of colchicine in Arab patients presenting with recurrent episodic fever.

[See also: Kuwait > Samilchuk, 2005].

Kuwait

In a study of FMF in Kuwait, Barakat et al. (1986) reported on an 11-year experience with 175 Arab patients. The most common manifestation was peritonitis (94%), followed by arthritis (34%) and pleurisy (32%). Amyloidosis, rashes, hepatosplenomegaly, and lymphadenopathy were rare. Barakat et al. (1986) referred to FMF as 'recurrent hereditary polyserositis.'

Later, Barakat et al. (1988a) described a patient suffering from Mollaret's meningitis associated with recurrent hereditary polyserositis (familial Mediterranean fever) that was induced by metaraminol provocative infusion. Barakat et al. (1988a) suggested the possibility of these two disorders presenting different manifestations of a single disorder. Also, Barakat et al. (1988b) assessed the value of using plasma dopamine beta-hydroxylase (DBH) activity as a diagnostic tool for the detection of FMF. The study sample consisted of 91 FMF patients and 162 controls. Assay showed a significantly higher DBH activity in patients, both symptom-free and with acute attacks, than in the controls. Treatment with colchicines was found to bring down the DBH activity to normal levels in patients. This method of diagnosis was found to offer high levels of diagnostic accuracy and specicificity for FMF.

In 1989, Barakat et al. (1989) compared the plasma and urinary catecholamine profiles of patients before and during attack. The results showed that compared to controls, patients had higher urinary and lower plasma dopamine levels. The significantly low urinary epinephrine in patients, and the raised urinary metanephrine levels in the asymptomatic state, without a change in the attack stage, pointed towards a defect in the renal clearance of these compounds. Induction of attack was associated with an increase in the plasma levels of dopamine and epinephrine, without any increase in the urinary levels of these metabolites. Barakat et al. (1989) suggested that defects in the renal clearance mechanism were responsible for dissociation between the plasma and urinary levels of these catecholamines, which in turn would lead to a retention of these metabolites in the plasma, and their subsequent leakage through the serous membranes, inciting an acute inflammatory response.

One year later, Barakat et al. (1990) studied the differential responsiveness of peripheral blood cells to stimulation with phytohemagglutinin and reported hyporesponsiveness among cells from patients with recurrent hereditary polyserositis during attack-free intervals in comparison to healthy controls. A lesser degree of hyporesponsiveness was found in regards to producing interferon-alpha after stimulating the cells with Sendai virus. Colchicine therapy is considered effective in restoring cellular responsiveness regarding interferon-alpha and interferon-gamma production although this could only be elucidated indirectly. [Barakat MH, Strannegard OO, Fenech FF. Interferon production in patients with recurrent hereditary polyserositis. Med Princ Pract. 1990; 2(3-4):185-9.]

Majeed et al. (1990) studied 46 children with FMF, and found that 20 (43%) had cutaneous manifestations. These manifestations included non-specific purpuric rash (26%), erysipelas-like erythemas (22%), Henoch-Schonlein purpura (13%), diffuse erythema of the face and/or trunk, angioneurotic edema, diffuse erythema of palms and soles, Raynaud's phenomenon, and a subcutaneous nodule. Majeed et al. (1990) concluded that skin involvement was an integral part of FMF.

In his study of single gene disorders in Kuwait, Samilchuk (2005) detected only one referral for mutation testing for FMF. This was a Jordanian family, in which two affected sibs were found to carry the same homozygous mutation.

Lebanon

Reimann et al. (1954) described 72 cases of FMF from Lebanon, most of them Armenian. In one remarkable family, survivors of the siege of Musa Dagh, 20 affected persons occurred in 5 generations, with 3 instances of skips in the pedigree. 

Dodé et al. (2000) identified MEFV variants in a large cohort of patients with a clinical diagnosis of FMF.

Boujaoude et al. (2007) studied a patient with severe diarrhoea and confirmed a diagnosis of gastrointestinal amyloidosis secondary to FMF. 

Jalkh et al. (2008) carried out a haplotype analysis of 376 FMF patients and studied the founder effects for different MEFV mutations.

Mahfouz et al (2009) found a higher prevalence of KIR3DP1*003 among Lebanese patients with FMF as compared to controls.  

Medlej-Hashim et al. (2010) uncovered 5 novel splicing events in the MEFV gene of FMF patients and healthy controls. 

Jeske et al. (2013) found that the homozygous p.Met694Val variant was associated with a more severe disease activity in a cohort of FMF affected children. 

Mahfouz et al. (2017) found significant overexpression of the receptor proteins HLA-DQA1 and HLA-DQB1 among FMF patients when compared to controls. 

Libya

Dajani et al. (1987) described a 55 years old woman from Libya residing in the UAE who was diagnosed as having periodic peritonitis, or familial Mediterranean fever. The patient suffered from fever and acute self-limiting attacks of abdominal pain. She underwent two abdominal operations previously. Also, she had peripheral joints involvement and cervical spondylosis. Ultrasonological examination showed that the patient had gallbladder stones during an episode of abdominal pain, but cholecystectomy did not improve the symptoms. Metaraminol provocation was then performed three days after stopping maintenance colchicine therapy to confirm the diagnosis. It was found that the patient reacted positively to the metaraminol infusion by reproducing the attacks she experienced before. The patient had already shown a significant control of the illness by colchicine, whether during the acute attacks or during prophylactic maintenance therapy. [Dajani AI, Awad SM, Jaber YI. Diagnosis of periodic peritonitis - Evaluation of metaraminol provocation test and colchicine therapeutic trial. Emirates Med J. 1987; 5:133-7.]

Using extended pedigree data of 90 FMF probands, Daniels et al. (1995) calculated the FMF gene frequency in various ethnic groups in Palestine by analyzing the frequency in a total of 2,312 first cousins. The heterozygote frequencies were as follows: 1 in 4.9 (0.2 +/- 0.06) for the Libyan subgroup; 1 in 6.4 (0.16 +/- 0.03) for the subgroup from other North African countries; 1 in 13.3 (0.07 +/- 0.04) for the Iraqi subgroup; 1 in 11.4 (0.09 +/- 0.06) for the Ashkenazi subgroup; and 1 in 29.4 (0.03 +/- 0.03) for the remaining ethnic groups. The observed number of affected parents and affected offspring of probands was in agreement with the estimated gene frequency. Pras et al. (1998) commented that North African Jews were found to have more severe disease manifested by earlier age of onset, increase in frequency and severity of joint involvement, higher incidence of erysipelas-like erythema, and higher dose of colchicine required to control symptoms.

 

Morocco

Schwabe and Monroe (1988) described a 32-year-old non-Ashkenazi Jewish man in whom meningitis first developed in Morocco at the age of 1 year. Between the ages of 26 and 31 years, he had 6 attacks of fever, frontal headache, nausea, and stiff neck, with positive Kernig and Brudzinski signs.

Aksentijevich et al. (1993) observed different haplotypes associated with the disease in strong linkage disequilibrium in Moroccan and Iraqi Jewish families. This, together with the fact that Moroccans had a much more severe form of FMF, suggested that the two groups carry different allelic mutations.

Using linkage disequilibrium mapping in the study of 65 Jewish, Armenian, and Arab families, Levy et al. (1996) obtained a maximum lod score of 49.2 at a location 1.6 cM centromeric to D16S246. A specific haplotype using 3 markers was found in 76% of Moroccan and 32% of non-Moroccan Jewish carrier chromosomes, but this haplotype was not overrepresented in Armenian or Arab FMF carriers. Since the Moroccan Jewish community represents a relatively recently established and genetically isolated founder population, Levy et al. (1996) analyzed the Moroccan linkage-disequilibrium data and placed the FMF susceptibility gene within 0.305 cM of D16S246.

 

Palestine

Zayyani (1987) described three Palestinian Arabs in her description of the very first cases of FMF from the Arabian Peninsula.  Two brothers (32 and 37-years old) born to consanguineous parents presented with a history of recurrent attacks of fever, and abdominal pain, starting in the right lower quadrant and spreading to the whole abdomen.  The attacks lasted for one to three days, and recurred once or twice every month.  The elder brother had undergone an appendectomy during an attack.  Radiographs showed distended small and large bowel.  The younger brother underwent a metaramiol provocative test, which precipitated his attack within seven hours.  FMF was thereby confirmed, and he was put on colchicine treatment.  In the subsequent year, he had no recurrence of the attacks.  His brother refused the metaraminol challenge.  He was, however, put on colchicine too.  During ten months of follow-up, he had one recurrence of the attack. [Zayyani NR. Familial Mediterranean fever in the Arabian Peninsula: Case reports and review of literature. Bahrain Med Bull. 1987; 9(3):130-6.]

Dajani et al. (1987) described three Palestinian male patients (two of them were brothers) residing in the UAE who were diagnosed as having periodic peritonitis, or familial Mediterranean fever.  Their ages ranged between 35 to 45 years.  Patients suffered from fever and acute self-limiting attacks of abdominal pain.  They underwent an abdominal operation previously.  Pleuritic chest pain was seen in the three patients and two of them had a pleural rub during the attack.  Two patients had cervical spondylosis and one had peripheral joints involvement.  Metaraminol provocation was then performed three days after stopping maintenance colchicine therapy to confirm the diagnosis.  The patients were found to react positively to the metaraminol infusion by reproducing the attacks they experienced before.  All of the patients had already shown a significant control of the illness by colchicine, whether during the acute attacks or during prophylactic maintenance therapy. [Dajani AI, Awad SM, Jaber YI. Diagnosis of periodic peritonitis - Evaluation of metaraminol provocation test and colchicine therapeutic trial. Emirates Med J. 1987; 5:133-7.]

Ayesh et al. (2005) conducted a study to investigate pyrin gene mutations among Palestinians with familial Mediterranean fever.  The clinical characteristics were variable among the 511 patients; 281 patients had abdominal pain, 227 had fever, 172 had arthralgia, 125 had chest pain, and 118 had back pain.  The patients’ ages were between 2-59 years, and the male to female ratio was 1.3:1.  Twenty four common FMF mutations found in the 511 suspected FMF patients.  Among these patients, 299 were positive for one, 2 or 3 of the known FMF mutations.

[See also: Iraq > Pras et al., 1998; Jordan > Rawashdeh and Majeed, 1996; Jordan > Majeed et al., 1999; Libya > Damiels et al., 1995].

Saudi Arabia

Majeed and Barakat (1989) conducted a retrospective study to assess the clinical profile, course and complications of familial Mediterranean fever (recurrent hereditary polyserositis) seen in 88 children over a period of 11 years. The group included 48 children (55%) who had onset before the age of 5 years (mean 4.9 years). Peritonitis occurred in 85% of children, arthritis in 50%, pleuritis in 33% and erysipelas-like lesions in 16%. Two children developed renal amyloidosis, and one third of the children were subjected to unnecessary operative surgery, reflecting the diagnostic difficulties. The arthritis was mono-articular in 80% and polyarticular in 20% of children with arthritis, and was seronegative (rheumatoid factor and antinuclear antibodies). Human leucocyte antigen (HLA) typing for the B-27 antigen carried out in ten children with arthritis was negative. The synovial attack showed a wide variation in the clinical presentation, course and duration of arthritis, causing diagnostic difficulties. Of 45 children treated with colchicine, 42 children (93%) achieved a therapeutic response.

[See also: Bahrain > Zayyani, 1987].

Syria

Dajani et al. (1987) described two Syrian women residing in the UAE who were diagnosed as having periodic peritonitis, or familial Mediterranean fever. One of them was 24 years old and the other was 30 years old. The patients suffered from fever and acute self-limiting attacks of abdominal pain. The older patient had two abdominal operations previously, while the younger had only one. Peripheral joints involvement was observed in the older case. Metaraminol provocation was then performed three days after stopping maintenance colchicine therapy to confirm the diagnosis. The patients were found to react positively to the metaraminol infusion by reproducing the attacks they experienced before. All of the patients had already shown a significant control of the illness by colchicine, whether during the acute attacks or during prophylactic maintenance therapy.

[Dajani AI, Awad SM, Jaber YI. Diagnosis of periodic peritonitis - Evaluation of metaraminol provocation test and colchicine therapeutic trial. Emirates Med J. 1987; 5:133-7.]

[See: Jordan > Rawashdeh and Majeed, 1996]

United Arab Emirates

[See: Egypt, Libya, Palestine, and Syria > Dajani et al., 1987].

© CAGS 2021. All rights reserved.